Can you beat our Nanopore read error correction? We hope so!

Tagging of individual molecules has been used as an effective consensus error-correction strategy for Illumina data (Kivioja et al 2011, Burke et al 2016Zhang et al 2016) and the principle is similar to the circular consensus sequencing strategy used to generate consensus reads with error rate of < 1 % on the PacBio (Travers et al 2010, Schloss et al 2016, Singer et al 2016) and the Oxford Nanopore platforms (Li et al 2016). You simply sequence the same molecule several times and compare the reads to generate a consensus with a better accuracy than the individual reads. As far as we know a tag-based consensus error correction strategy has not been attempted for long reads before, probably because the raw error rate complicates identification of the tags. However, we see several benefits of the tag-based strategy in the long run, which is why we decided to pursue it.

My colleague @SorenKarst tested tag-based error correction on the Nanopore MinION in connection with our work on generating primer free, full length 16S/18S sequences from  environmental rRNA (see our bioRxiv paper: Karst et al 2016). The main approach used in the paper is based on Illumina sequencing inspired by Burke et al 2016, but moving to nanopore sequencing in the future would make the approach considerably easier.  His approach was relatively “simple”; individual cDNA molecules were uniquely tagged at both ends with a 10 bp random sequence, then diluted to a few thousand molecules, amplified by PCR to generate 1000’s of copies of each molecule, which were prepared for 2D sequencing on the Nanopore MinION. The resulting sequence reads were binned based on the unique tags, which  indicated they originated from the same parent molecule, and a consensus was generated from each read bin. The approach was tested on a simple mock community with three reference organisms (E. Coli MG 1655, B. Subtilis str. 168, and P. aeruginosa PAO1), which allowed us to calculate error rates.

For locating the unique tags we used cutadapt with loose settings to locate flanking adaptor sequences and extract the tag sequences. The tags were clustered and filtered based on abundance to remove false tags. As tags and adaptors contain errors, it can be a challenge to cluster the tags correctly without merging groups that do not belong together. Afterwards the filtered tags were used to extract and bin sequence reads using a custom perl script ;). For each bin we used the CANU correction tool followed by USEARCH consensus calling. By this very naive approach we were able to improve the median sequence similarity from 90% to 99%.

We think this is a good start, but we are sure that someone in the nanopore community will be able to come up with a better solution to improve the error rate even further. The data is freely available and a short description of the sequence read composition is provided below. We are looking forward to hear your inputs!

Ps. If you come up with a solution that beats our “quick and dirty” one and post it here or on twitter, I will make sure to mention you in my slides at ASM ;).

 

Data and script availability:

The nanopore reads are available as fastq at: 2D.fq or fasta: 2Dr.fa and fast5: PRJEB20906

The 16S rRNA gene reference sequences: mockrRNAall.fasta

Scripts:

Our approach in a shell script
#############################################################################
# 									    #
# Shell script for generating error corrected FL16S and getting error rates #
#									    #
# Use at your own RISK!							    #
#############################################################################

####################
#     Variables    #
####################
ID_adapt=0.1;
ID_cluster=0.8;
LINKtoCANU=/space/users/rkirke08/Desktop/canu/canu-1.3/Linux-amd64/bin;
# Update path to include poretools installation
# export PATH=$PATH:/space/users/rkirke08/.local/bin
####################
# End of variables #
####################
###############################################
# Depends on the following files and software #
###############################################
# folder with fast5 files "data/pass/"
# file with reference 16S sequences "mockrRNAall.fasta"
# perl script "F16S.cluster.split.pl"
# poretools
# cutadapt
# usearch8.1
# CANU
###############################################
# End of dependencies			      #
###############################################

# Extract fastq files
# poretools fastq --type 2D data/pass/ > data/2D.fq


# Rename headers (Some tools do not accept the long poretools headers)
#awk '{print (NR%4 == 1) ? "@" ++i : $0}' data/2D.fq | sed -n '1~4s/^@/>/p;2~4p' > 2Dr.fa

# Find adapters
cutadapt -g AAAGATGAAGAT -e $ID_adapt -O 12 -m 1300 --untrimmed-output un1.fa -o a1.fa 2Dr.fa
cutadapt -a ATGGATGAGTCT -e $ID_adapt -O 12 -m 1300 --discard-untrimmed -o a1_a2.fa a1.fa

usearch8.1 -fastx_revcomp un1.fa -label_suffix _RC -fastaout un1_rc.fa
cutadapt -g AAAGATGAAGAT -e $ID_adapt -O 12 -m 1300 --discard-untrimmed -o ua1.fa un1_rc.fa
cutadapt -a ATGGATGAGTCT -e $ID_adapt -O 12 -m 1300 --discard-untrimmed -o ua1_a2.fa ua1.fa

cat a1_a2.fa ua1_a2.fa > c.fa

# Extract barcodes
cut -c1-12 c.fa > i1.fa
rev c.fa | cut -c1-12 | rev > i2.fa

paste i1.fa i2.fa -d "" | cut -f1-2 -d ">" > i1i2.fa


# Cluster barcodes
usearch8.1 -cluster_fast i1i2.fa -id $ID_cluster -centroids nr.fa -uc res.uc -sizeout

# Extract raw sequences
perl F16S.cluster.split.pl -c res.uc -i c.fa -m 3 -f 50 -r 40
# Count number of files in directory
find clusters -type f | wc -l

FILES=clusters/*.fa
for OTU in $FILES

do
  wc -l $OTU >> lines.txt	
done

FILES=clusters/*.fa
for OTU in $FILES

do
  OTUNO=$(echo $OTU | cut -f2 -d\/);
  # Rename header
  sed "s/>/>$OTUNO/" clusters/$OTUNO > clusters/newHeaders_$OTUNO

  # Correct reads using CANU
  $LINKtoCANU/canu -correct -p OTU_$OTUNO -d clusters/OTU_$OTUNO genomeSize=1.5k -nanopore-raw  $OTU

  # Unsip corrected reads
  gunzip clusters/OTU_$OTUNO/OTU_$OTUNO.correctedReads.fasta.gz

  sed -i "s/>/>$OTUNO/" clusters/OTU_$OTUNO/OTU_$OTUNO.correctedReads.fasta

  # Call consensus using Usearch
  usearch8.1 -cluster_fast clusters/OTU_$OTUNO/OTU_$OTUNO.correctedReads.fasta -id 0.9 -centroids clusters/OTU_$OTUNO/nr_cor_$OTUNO.fa -uc clusters/OTU_$OTUNO/res_$OTUNO.uc -sizeout -consout clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa

  sed -i "s/>/>$OTUNO/" clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa

  # Map reads to references to estimate error rate
  # Raw reads
  # Map FL16S back to references
  usearch8.1 -usearch_global clusters/newHeaders_$OTUNO -db mockrRNAall.fasta -strand both -id 0.60 -top_hit_only -maxaccepts 10 -query_cov 0.5 -userout clusters/map_raw_$OTUNO.txt -userfields query+target+id+ql+tl+alnlen

  # Usearch consensus corrected sequence
  # Map FL16S back to references
  usearch8.1 -usearch_global clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa -db mockrRNAall.fasta -strand both -id 0.60 -top_hit_only -maxaccepts 10 -query_cov 0.5 -userout clusters/map_cor_Ucons_$OTUNO.txt -userfields query+target+id+ql+tl+alnlen

  cat clusters/map_raw_$OTUNO.txt >> myfile.txt
  cat clusters/map_cor_Ucons_$OTUNO.txt >> myfile.txt

  # Collect corrected sequences
  cat clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa >> final_corrected.fa
done

Requirements:

cutadapt

USEARCH

a perl script F16S-cluster.split.pl

cDNA molecule composition

The cDNA molecules are tagged by attaching adaptors to each end of the molecule. The adaptor contains a priming site red, the unique 10 bp tag sequence (blue) and a flanking sequence (black). Note that the design is complicated as we simply modified it from our approach to get Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life.

AAAGATGAAGATNNNNNNNNNNCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTT<—- fragment of SSU cDNA molecule—->GGGCAATATCAGCACCAACAGAAATAGATCGCNNNNNNNNNNATGGATGAGTCT

The number of T’s before the fragment will vary between molecules because it is a result of the polyA tailing described in the paper. The black parts of the sequence are generally not needed for the purpose of Nanopore sequencing but are present in the molecule because they were needed for the illumina sequencing.

Example Nanopore sequence read:

>18125
GATCTGGCTTCGTTCGGTTACGTATTGCTGGGGGCAAAGATGAAGATGTTCGTTATTCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTGGTCAAGCCTCACGAGCAATTAGTACTGGTTAACTCAACGCCTCACAACGCTTACACACCCAGCCTATCAACGTCGTAGTCTCCGACGGCCCTTCAGGGGAATCAAGTTCCAGTGAGATCTCATCTTGAGGCAAGTTTCCGCTTAGATGCTTTCAGCGGTTATCTTTTCCGAACATGGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGTTCGTCCACCCGGTCCTTCCGTACTAGGAGCAGCCCCTCTCAAATTCAAACGTCCACGGCCAGATGGGGACCGAACTGTCTCACGACGTTCTAAGCCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATACCCTTAGACCGGCTTCAGCCCCAGGATGTGATGAGCCGACATCGAGGTGCCAAACACCGCCGTCGATAAACTCTTGGGCGGTATCAGCCTGTTATCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCTTCCATACAGAACCACCGGATCTTCAAGACCTACTTTCGTACCTGCTCGACGTGTCTGCTCTGATCAAGCGCTTTTGCCTTTATATTCTCTGCGACCGATTTCCGACCGGTCTGAGCGCACCTTCGTGGTACTCCTCCGTTACTCTTTTAGGAGGAGACCGCCCCAGTCAAACTGCCCACCATACACTGTCCTCGATCCGGATTACGGACCAGAGTTAGAACCTCAAGCATGCCAGGATGGTGATTTCAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCCACCTAATCCTACACAGCAGGCTCAGTCCAGTGCCGCTACAGTAAAGGTTCACGGGGTCTTTCCGTCGCCGCGGATACACTGCATCTTCACAGCGATTTCAATTTCACTGAGTCTCGGGTGGAGACAGCGCCGCCATCGTTACGCCACTCGTGCAGGTCGGAACTTACCCGACAAGGAATTTCGCTACCTTGGACCGTTATCGTTACGGCCGCCGTTTACCGGGGCTAGATCAGGCTTCGCGCCCCATCAATACTTCCGGCACCGGGAGGCGTCACACTTATACGCCGTCCACTTTCGTGTTTTGCAGAGTGCTGTGTTTTTAATAAACAGTCGCAGCGGCCTGGTATCTTCGACCAGCCAGAGCTTACGGAGTAAATCCTTCACCCTAGCCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTGCCTAGTTCCTTCACCCGAGTTCTCAAGCGCCTTGGTATTCTCTACCCGACCACCTGTGTCGGTTTGGGTGCAGTTCCTGGTGCCTGAAGCTTAGAAGCTTTTGGAAGCATGGCATCAACCACTTCGTCGTCTAAAAGACGACTCGTCATCAACTCTCGGCCTTGAAACCCCGGATTTACCTAAGATTTCAGCCTACCACCTTAAACTTGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGGTGGAACGTTCTGTTTATGTTTCTGAAA

Example cluster with same random sequence:

>18125
GATCTGGCTTCGTTCGGTTACGTATTGCTGGGGGCAAAGATGAAGATGTTCGTTATTCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTGGTCAAGCCTCACGAGCAATTAGTACTGGTTAACTCAACGCCTCACAACGCTTACACACCCAGCCTATCAACGTCGTAGTCTCCGACGGCCCTTCAGGGGAATCAAGTTCCAGTGAGATCTCATCTTGAGGCAAGTTTCCGCTTAGATGCTTTCAGCGGTTATCTTTTCCGAACATGGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGTTCGTCCACCCGGTCCTTCCGTACTAGGAGCAGCCCCTCTCAAATTCAAACGTCCACGGCCAGATGGGGACCGAACTGTCTCACGACGTTCTAAGCCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATACCCTTAGACCGGCTTCAGCCCCAGGATGTGATGAGCCGACATCGAGGTGCCAAACACCGCCGTCGATAAACTCTTGGGCGGTATCAGCCTGTTATCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCTTCCATACAGAACCACCGGATCTTCAAGACCTACTTTCGTACCTGCTCGACGTGTCTGCTCTGATCAAGCGCTTTTGCCTTTATATTCTCTGCGACCGATTTCCGACCGGTCTGAGCGCACCTTCGTGGTACTCCTCCGTTACTCTTTTAGGAGGAGACCGCCCCAGTCAAACTGCCCACCATACACTGTCCTCGATCCGGATTACGGACCAGAGTTAGAACCTCAAGCATGCCAGGATGGTGATTTCAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCCACCTAATCCTACACAGCAGGCTCAGTCCAGTGCCGCTACAGTAAAGGTTCACGGGGTCTTTCCGTCGCCGCGGATACACTGCATCTTCACAGCGATTTCAATTTCACTGAGTCTCGGGTGGAGACAGCGCCGCCATCGTTACGCCACTCGTGCAGGTCGGAACTTACCCGACAAGGAATTTCGCTACCTTGGACCGTTATCGTTACGGCCGCCGTTTACCGGGGCTAGATCAGGCTTCGCGCCCCATCAATACTTCCGGCACCGGGAGGCGTCACACTTATACGCCGTCCACTTTCGTGTTTTGCAGAGTGCTGTGTTTTTAATAAACAGTCGCAGCGGCCTGGTATCTTCGACCAGCCAGAGCTTACGGAGTAAATCCTTCACCCTAGCCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTGCCTAGTTCCTTCACCCGAGTTCTCAAGCGCCTTGGTATTCTCTACCCGACCACCTGTGTCGGTTTGGGTGCAGTTCCTGGTGCCTGAAGCTTAGAAGCTTTTGGAAGCATGGCATCAACCACTTCGTCGTCTAAAAGACGACTCGTCATCAACTCTCGGCCTTGAAACCCCGGATTTACCTAAGATTTCAGCCTACCACCTTAAACTTGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGGTGGAACGTTCTGTTTATGTTTCTGAAA
>42262
AGCGTTCAGATTACGTATTGCTAGGGGGCAAAGATGAAGATGTTCGTTATTCTTTAGACTTGCCTGTCGCTCTATCTTCTCTTTTTGGTCAAGCCTCACGGGCAATTAGTACTGGTTAGCTCAACGCCTCACAACGCTTACAGCCTATCAACGTCATAATTCTTCTGACGGCCCTTCAGAATCAAGTTCCCAGTGAGATCTCATCTTGAGCAAGTTTCCCACCGTCTTTCAGCGGTTATCTTTTCGAACCTGCTTCCAGCAATACCACTGGCGTGACAACCGGAACACCAGAGGTTCGTCCACTCCGGTCCTCTCCGTACTAGGGCAGCCCTCTCAAATCTCAGAACGTCCACGGCAGATAGGACCGAACTGTCTCACGACGTTCTAAGCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATGCAGGACCGGCTTCGGCCCCAGGATGTGATGAGCCGGCATCGGGTGCCAAACACCGCCGTCGATATAAACTCGGGCATTGACCTGTTATCCCCGGGTACCTTTTTATCGTTGAGCGATGGCCCTTCCATACCAGAACCACCGGATCACTACAGACCTACTTTCGTACCTGCTCGCTGTCTGTCGCGGCCAAGCGCTTTTGCTATGCTCTGCGACCGATTTCCGACCGGTCTGGGCGCACCTTCGTACTCCGTTGCCTCTTTTGGAGACCGCTGATCAAACTGCCCACCATACACTGTCCTCGATCCGGATTACCAGAGTTTAGAACTCAATGCCAGGGTGGTATTTCAAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCACCTATCCTACAAGCAGGCTCAAAGTCCAGTACAACTACAGTAGGTTCACGGGGTCTTTCCGTCTAGCCGCGGATACCTGCATCTTCAGCGTTTCAATTTCACTGAGTCTCAGGTGGAGACAGCGCCGCCATCGTTACGCCATTCGTGCAGGTCGGAACTTGCCGACAAGGAATTTTGCACCTTGGGACCATTCGTTACGCCGTTTACCGGGGCTGATCAAGAGCTTGCTTGCGCTAACCCCATCAATTAATTTTTCCGGCACCGGGGAGGCGTCACACCTACGTCCCACTGCGTGTTTGCAGAGTGCTGTGTTTAATAAGTCGCAGCAGCTCAGTATCTTCGACCAGCCAGAGCTTACGGAGTAAATCTTCACCTAGCCGGCGACCTTCTCCCGGAAGTTACGGTGCCATTTGCCTAGTTCCTCCGCACCCGAAAGCCCTTCGCGCCTTGGTATTCTCTACCCGACCTGTGTCGGTTTGGGGCACGGTTCCTGGCCTGAAGCAGAAGCTTTTCTTGGAAGCCTGGCATCAACCACTTCGTCATCTAAAAGACGACTCGTCATCAGCTCTCGGCCTTGAAACCGGATTTACCTAAGATTTCAGCCTACCACCTTAAACTTGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGTGGAGACGTTCTGTTTATGTTTCTATC
>50101
CCCGGTTACGTATTGCTAGGGGCAAAGATGAAGATGTTCGTTATTCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTGGTCAAGCCTGCGGGCAATTATACTGGATAGCTCAACGCCTCACAACGCATACACCCAGCTTCTATCAACGTCGTAGTCTTCGACGGCCCTTCAGGAATCAAGTTCCCAGTGAGATCTCATCTTGAGGCAAGTTTCCCGCTTAGATGCTTTCAGCGGTTATCTTTTCCGAACATAGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGGTTCGTCCACTCCGGTCCTCTCGTACTAGGAGCAGCCTCTCAAATCAAACGTCCACGGCAGATATAGGGACCGAACTGTCTCACGACGTTTCTAAACCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCACCCTTGGGACCGGCTTCAGCCCCAGGATGTGATGAGCCGACATCGGGAACAAACACCGCCGTCGATATAAACTCTTGGGCGGTATCAGCCTGTTATCCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCCTTCCATACAGAACCACCGGATCACTAAGACCTACTTTCGTACCTGCTCGACGTGTCTGTCTCGCAGTCAAGCGCGCTTTTGCTTTATACTCTGCGACCGATTTCCGACCGGTCTGAGCGCACCTTCGTACTCTCCGTTACTCTTTAGGAGACCGCCCCAGTCAAACTGCCCACCATACACTGTCCCTATCGATCCGGATTACGGACAGAGTTAGAACCTCAAGCATGCCAGGGTGGTATTTCAAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCACCTATCCTACACAAGCAGGCTCAAAGTCCAGTGCAAAGCTACAGTAAGGTTCACGGGTCTTTCCGTCTAGCCGCGGATACACTGCATCTCCACAGCGATTTCACCTCACTGAGTCTCTCGGGTGGAGACAGCGCCGCCATCGTTACGCCATTCGTGCAGGTCGGAACTTACCGACAAGGAATTTCGCTACCTTAGACCGTTATCGTTACGGCCGCCGTTTACCGGGGCTTCGATCAAGAGCTTCGCTTGCGCTAACCCCATCAATTAACCTTCGGCACCGGGGAGGCGTCACACCCTATACGTCCACTTTCGTGTTTGCAGAGTGCTGTGGCTTTTAATAAACAGTCGCAGCGGCCTGGTATCTTTTCGACCAGCCAGAGCTTACGGAGTAAATCCTTCACCTTAGCCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTGCTAGTTCCTTCACCCGAGTTCTCTCAAGCGCCTTGGTATTCTCTACCCGACCACCTGTGTCGGTTTGGGGTACGGTTCTGGTTACCTGAAGCTTAGAAGCTTTTCTTGGAAGCATGGCATCAACCACTTCGTCGTCTAAAGACGACTCGTCATCAGCTCTCGGCCTTGAAACCCCGGATTTACCTAAAGATTTCAGCCTACCACCTTAAACTTAGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGGTGGAAGTTCTGTTTATGTTTCTTGAGC

Continue reading

Promethion configuration test and “reboxing”

Following our PromethION unboxing event we have finally managed to connect the machine to our University network and pass the configuration run. The configuration test demonstrates that the network can handle the data produced and transfer it fast enough to a network storage solution.

 

After a successful configuration test (millions of fast5 files generated) we contacted Oxford Nanopore and they organised to pick up the configuration unit.

So now we just have to wait for the sequencing unit which they mentioned should be available around the end of February (Pretty soon!). Maybe the CTO is building it himself this very moment.

The hardware installation was super-easy, but the network configuration was a challenge. The PromethION settings are controlled through a web-interface, which seem to run some configuration scripts whenever we have changed something and submitted the change. However, it is not completely transparent what is going on and handling the PromethION as a “black” box system with multiple network interfaces was not exactly straightforward. Furthermore, our University runs what they call an “enterprise configuration”. This essentially means that we are not allowed to play with settings, and in order to ensure maintenance of the entire network is feasible, we cannot make too many “quick and dirty” workarounds.

Hence, our local IT-experts have been essential in getting the PromethION up and running!

I would highly recommend that you get your hands on a “linux ninja” and a true network expert if you risk running into non standard configurations (My personal guess is that it would probably have worked fairly straightforward if we would have plugged it into a standard off the shelf router with default configuration).

Our IT guys came up with the following wishes for improving the network setup:

“For faster understanding of the device, it would be nice with a network drawing, and maybe a few lines on how it is designed to work (for a Sysadmin or Network admin)

The possibility to use static address for everything should be possible.

It would be really nice if you could tell the setup script a start or end IP. We had to reconfigure our network because setup insisted on using, the top 2 addresses in the /24 network we had assigned to it (.253 and .254) which are used for HRSP in our network. We had to remove HSRP, on our 10G network and enable DHCP on the local server network (Ethernet), which is not desirable.

Having a “management” interface on a DHCP assigned address, is a hassle. Allow static addresses, so its easy to use DNS names in stead of guessing IP´s

Allow configuring static DNS.

The test device came with static defined routes

172.16.0.0 255.240.0.0
192.168.0.0 (Cant remember subnet on this one)

Both are problematic, as they are WAY bigger than they need to.

Especially 172.16.0.0 is problematic for our network, as our DNS servers are on 172.18.x.y

I did not find any good reason for 172.16 anywhere.
192.168 I am guessing is there for the Default setup. That should in my point of view be limited to 192.16.253.0 as this is the actual range used. Static routes can be needed, but should be kept as small as possible”

Promethion unboxing

Following our experiences with DNA sequencing using the MinION since 2014 as a part of the Minion (early) Access Programme (MAP), and their developers programme we applied for a spot on the PromethION Early Access Programme (PEAP) back in May 2015. The MinION was the mindblowing DNA sequencer that allows you to do long read (no fixed limit) DNA sequencing by plugging it into a laptop!!! It was an absolutely amazing piece of tech, but the initial throughput was not enough for our aim of retrieving the complete (and closed) genomes from all the abundant organisms in complex samples such as wastewater treatment systems. The PromethION promised a solution to this lack of throughput by having 48 times more flow-cells with 6 times more pores in each cell.

As we were waiting for the Promethion, we used the MinION frequently and our first try at a metagenome sample was a simple two species culture where we used the long reads to scaffold the Nitrospira genome and thus helped show that all the genes neeeded for complete nitrification were present in a single organism (Comammox). At the time, we could scaffold the illumina based assembly with some nanopore reads, but since then ONT has improved their technology tremendously and people have started to get data in the ~5 Gbp range from a single flowcell.

Hence, back-of-the-envelope calculations says that without any further improvements the PromethION would now be able to generate:

[5Gbp pr. flowcell]  * [6 x number of pores] * [48 flowcells] = 1440 Gbp (in just ~48hrs)

In other words equivalent to 288.000X coverage of a microbial genome of 5 Mbp (1440000 Mbp/5 Mbp). If we want to retrive genomes of organisms at 0.1% abundance that would still amount to 288 X coverage! While we expected improvements in throughput, we never foresaw that it would come this quick and then suddenly the day came where our Promethion configuration unit arrived. The unit was delivered by ONT in a small van and we had a nice little unboxing experience. The Nanopore hype have finally reached the entire department that have started dreaming about applications for long read sequencing.

As the PromethION is expected to produce massive amounts of data in very little time the need for fast data transport and storage is another challenge. Even storing data for a single MinION is causing trouble for people.

ONT therefore ships a PromethION configuration unit to test whether the local infrastructure is ready before shipping the actual PromethION. The accompanying manual states that the maximum expected signal data output would be 80GB/hr per flowcell. The spec sheet for a NAS server suggested by ONT to move the data away from the PromethION itself, while running the sequencing, includes 2 fibre connections and 12*6 TB SSDs to support the internal buffer of 24 TB SDD storage on the PromethION. This amount of SSD storage at enterprise quality does not come cheap and only covers a machine for temporary storage, not the following bioinformatic computations. Compute costs should does not be neglected in the considerations regarding  buying a PromethION. As prices tend to drop fast for computer equipment, postponing any unnecessary upgrades could save you a lot of money or give you much more compute power for the same amount. We therefore planned to buy a “cheap” storage server (for now) with the specs below to hopefully meet the needs for the configuration unit and pass the test.

  • 768 GB ram
  • 2 x Intel Xeon 2650v4 (12 cores each)
  • 768gb DDR4 ram 2400MHZ
  • 2 x 400gb SSD (for the OS)
  • 16 x 8TB NLSAS (12gbps)
  • 2 x 10gbit sfp+ fibre ports

We plan to upgrade our entire compute facility when we get a better overview of the true needs for running the sequencing and bioinformatics. With PromethION level output of signal data we do not expect that we will be able to store or upload the raw data files to the read archives in long term, but would hopefully obtain fastq or fasta files as early as possible and discard the raw signals. Re-sequencing samples can probably end up being a lot cheaper than storing raw signal data.

Currently, we are working with our IT support department to get everything connected and hope to be able to share a “hello world” from the PromethION soon!