Can you beat our Nanopore read error correction? We hope so!

Tagging of individual molecules has been used as an effective consensus error-correction strategy for Illumina data (Kivioja et al 2011, Burke et al 2016Zhang et al 2016) and the principle is similar to the circular consensus sequencing strategy used to generate consensus reads with error rate of < 1 % on the PacBio (Travers et al 2010, Schloss et al 2016, Singer et al 2016) and the Oxford Nanopore platforms (Li et al 2016). You simply sequence the same molecule several times and compare the reads to generate a consensus with a better accuracy than the individual reads. As far as we know a tag-based consensus error correction strategy has not been attempted for long reads before, probably because the raw error rate complicates identification of the tags. However, we see several benefits of the tag-based strategy in the long run, which is why we decided to pursue it.

My colleague @SorenKarst tested tag-based error correction on the Nanopore MinION in connection with our work on generating primer free, full length 16S/18S sequences from  environmental rRNA (see our bioRxiv paper: Karst et al 2016). The main approach used in the paper is based on Illumina sequencing inspired by Burke et al 2016, but moving to nanopore sequencing in the future would make the approach considerably easier.  His approach was relatively “simple”; individual cDNA molecules were uniquely tagged at both ends with a 10 bp random sequence, then diluted to a few thousand molecules, amplified by PCR to generate 1000’s of copies of each molecule, which were prepared for 2D sequencing on the Nanopore MinION. The resulting sequence reads were binned based on the unique tags, which  indicated they originated from the same parent molecule, and a consensus was generated from each read bin. The approach was tested on a simple mock community with three reference organisms (E. Coli MG 1655, B. Subtilis str. 168, and P. aeruginosa PAO1), which allowed us to calculate error rates.

For locating the unique tags we used cutadapt with loose settings to locate flanking adaptor sequences and extract the tag sequences. The tags were clustered and filtered based on abundance to remove false tags. As tags and adaptors contain errors, it can be a challenge to cluster the tags correctly without merging groups that do not belong together. Afterwards the filtered tags were used to extract and bin sequence reads using a custom perl script ;). For each bin we used the CANU correction tool followed by USEARCH consensus calling. By this very naive approach we were able to improve the median sequence similarity from 90% to 99%.

We think this is a good start, but we are sure that someone in the nanopore community will be able to come up with a better solution to improve the error rate even further. The data is freely available and a short description of the sequence read composition is provided below. We are looking forward to hear your inputs!

Ps. If you come up with a solution that beats our “quick and dirty” one and post it here or on twitter, I will make sure to mention you in my slides at ASM ;).

 

Data and script availability:

The nanopore reads are available as fastq at: 2D.fq or fasta: 2Dr.fa and fast5: PRJEB20906

The 16S rRNA gene reference sequences: mockrRNAall.fasta

Scripts:

Our approach in a shell script
#############################################################################
# 									    #
# Shell script for generating error corrected FL16S and getting error rates #
#									    #
# Use at your own RISK!							    #
#############################################################################

####################
#     Variables    #
####################
ID_adapt=0.1;
ID_cluster=0.8;
LINKtoCANU=/space/users/rkirke08/Desktop/canu/canu-1.3/Linux-amd64/bin;
# Update path to include poretools installation
# export PATH=$PATH:/space/users/rkirke08/.local/bin
####################
# End of variables #
####################
###############################################
# Depends on the following files and software #
###############################################
# folder with fast5 files "data/pass/"
# file with reference 16S sequences "mockrRNAall.fasta"
# perl script "F16S.cluster.split.pl"
# poretools
# cutadapt
# usearch8.1
# CANU
###############################################
# End of dependencies			      #
###############################################

# Extract fastq files
# poretools fastq --type 2D data/pass/ > data/2D.fq


# Rename headers (Some tools do not accept the long poretools headers)
#awk '{print (NR%4 == 1) ? "@" ++i : $0}' data/2D.fq | sed -n '1~4s/^@/>/p;2~4p' > 2Dr.fa

# Find adapters
cutadapt -g AAAGATGAAGAT -e $ID_adapt -O 12 -m 1300 --untrimmed-output un1.fa -o a1.fa 2Dr.fa
cutadapt -a ATGGATGAGTCT -e $ID_adapt -O 12 -m 1300 --discard-untrimmed -o a1_a2.fa a1.fa

usearch8.1 -fastx_revcomp un1.fa -label_suffix _RC -fastaout un1_rc.fa
cutadapt -g AAAGATGAAGAT -e $ID_adapt -O 12 -m 1300 --discard-untrimmed -o ua1.fa un1_rc.fa
cutadapt -a ATGGATGAGTCT -e $ID_adapt -O 12 -m 1300 --discard-untrimmed -o ua1_a2.fa ua1.fa

cat a1_a2.fa ua1_a2.fa > c.fa

# Extract barcodes
cut -c1-12 c.fa > i1.fa
rev c.fa | cut -c1-12 | rev > i2.fa

paste i1.fa i2.fa -d "" | cut -f1-2 -d ">" > i1i2.fa


# Cluster barcodes
usearch8.1 -cluster_fast i1i2.fa -id $ID_cluster -centroids nr.fa -uc res.uc -sizeout

# Extract raw sequences
perl F16S.cluster.split.pl -c res.uc -i c.fa -m 3 -f 50 -r 40
# Count number of files in directory
find clusters -type f | wc -l

FILES=clusters/*.fa
for OTU in $FILES

do
  wc -l $OTU >> lines.txt	
done

FILES=clusters/*.fa
for OTU in $FILES

do
  OTUNO=$(echo $OTU | cut -f2 -d\/);
  # Rename header
  sed "s/>/>$OTUNO/" clusters/$OTUNO > clusters/newHeaders_$OTUNO

  # Correct reads using CANU
  $LINKtoCANU/canu -correct -p OTU_$OTUNO -d clusters/OTU_$OTUNO genomeSize=1.5k -nanopore-raw  $OTU

  # Unsip corrected reads
  gunzip clusters/OTU_$OTUNO/OTU_$OTUNO.correctedReads.fasta.gz

  sed -i "s/>/>$OTUNO/" clusters/OTU_$OTUNO/OTU_$OTUNO.correctedReads.fasta

  # Call consensus using Usearch
  usearch8.1 -cluster_fast clusters/OTU_$OTUNO/OTU_$OTUNO.correctedReads.fasta -id 0.9 -centroids clusters/OTU_$OTUNO/nr_cor_$OTUNO.fa -uc clusters/OTU_$OTUNO/res_$OTUNO.uc -sizeout -consout clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa

  sed -i "s/>/>$OTUNO/" clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa

  # Map reads to references to estimate error rate
  # Raw reads
  # Map FL16S back to references
  usearch8.1 -usearch_global clusters/newHeaders_$OTUNO -db mockrRNAall.fasta -strand both -id 0.60 -top_hit_only -maxaccepts 10 -query_cov 0.5 -userout clusters/map_raw_$OTUNO.txt -userfields query+target+id+ql+tl+alnlen

  # Usearch consensus corrected sequence
  # Map FL16S back to references
  usearch8.1 -usearch_global clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa -db mockrRNAall.fasta -strand both -id 0.60 -top_hit_only -maxaccepts 10 -query_cov 0.5 -userout clusters/map_cor_Ucons_$OTUNO.txt -userfields query+target+id+ql+tl+alnlen

  cat clusters/map_raw_$OTUNO.txt >> myfile.txt
  cat clusters/map_cor_Ucons_$OTUNO.txt >> myfile.txt

  # Collect corrected sequences
  cat clusters/OTU_$OTUNO/Ucons_CANUcor_$OTUNO.fa >> final_corrected.fa
done

Requirements:

cutadapt

USEARCH

a perl script F16S-cluster.split.pl

cDNA molecule composition

The cDNA molecules are tagged by attaching adaptors to each end of the molecule. The adaptor contains a priming site red, the unique 10 bp tag sequence (blue) and a flanking sequence (black). Note that the design is complicated as we simply modified it from our approach to get Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life.

AAAGATGAAGATNNNNNNNNNNCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTT<—- fragment of SSU cDNA molecule—->GGGCAATATCAGCACCAACAGAAATAGATCGCNNNNNNNNNNATGGATGAGTCT

The number of T’s before the fragment will vary between molecules because it is a result of the polyA tailing described in the paper. The black parts of the sequence are generally not needed for the purpose of Nanopore sequencing but are present in the molecule because they were needed for the illumina sequencing.

Example Nanopore sequence read:

>18125
GATCTGGCTTCGTTCGGTTACGTATTGCTGGGGGCAAAGATGAAGATGTTCGTTATTCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTGGTCAAGCCTCACGAGCAATTAGTACTGGTTAACTCAACGCCTCACAACGCTTACACACCCAGCCTATCAACGTCGTAGTCTCCGACGGCCCTTCAGGGGAATCAAGTTCCAGTGAGATCTCATCTTGAGGCAAGTTTCCGCTTAGATGCTTTCAGCGGTTATCTTTTCCGAACATGGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGTTCGTCCACCCGGTCCTTCCGTACTAGGAGCAGCCCCTCTCAAATTCAAACGTCCACGGCCAGATGGGGACCGAACTGTCTCACGACGTTCTAAGCCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATACCCTTAGACCGGCTTCAGCCCCAGGATGTGATGAGCCGACATCGAGGTGCCAAACACCGCCGTCGATAAACTCTTGGGCGGTATCAGCCTGTTATCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCTTCCATACAGAACCACCGGATCTTCAAGACCTACTTTCGTACCTGCTCGACGTGTCTGCTCTGATCAAGCGCTTTTGCCTTTATATTCTCTGCGACCGATTTCCGACCGGTCTGAGCGCACCTTCGTGGTACTCCTCCGTTACTCTTTTAGGAGGAGACCGCCCCAGTCAAACTGCCCACCATACACTGTCCTCGATCCGGATTACGGACCAGAGTTAGAACCTCAAGCATGCCAGGATGGTGATTTCAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCCACCTAATCCTACACAGCAGGCTCAGTCCAGTGCCGCTACAGTAAAGGTTCACGGGGTCTTTCCGTCGCCGCGGATACACTGCATCTTCACAGCGATTTCAATTTCACTGAGTCTCGGGTGGAGACAGCGCCGCCATCGTTACGCCACTCGTGCAGGTCGGAACTTACCCGACAAGGAATTTCGCTACCTTGGACCGTTATCGTTACGGCCGCCGTTTACCGGGGCTAGATCAGGCTTCGCGCCCCATCAATACTTCCGGCACCGGGAGGCGTCACACTTATACGCCGTCCACTTTCGTGTTTTGCAGAGTGCTGTGTTTTTAATAAACAGTCGCAGCGGCCTGGTATCTTCGACCAGCCAGAGCTTACGGAGTAAATCCTTCACCCTAGCCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTGCCTAGTTCCTTCACCCGAGTTCTCAAGCGCCTTGGTATTCTCTACCCGACCACCTGTGTCGGTTTGGGTGCAGTTCCTGGTGCCTGAAGCTTAGAAGCTTTTGGAAGCATGGCATCAACCACTTCGTCGTCTAAAAGACGACTCGTCATCAACTCTCGGCCTTGAAACCCCGGATTTACCTAAGATTTCAGCCTACCACCTTAAACTTGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGGTGGAACGTTCTGTTTATGTTTCTGAAA

Example cluster with same random sequence:

>18125
GATCTGGCTTCGTTCGGTTACGTATTGCTGGGGGCAAAGATGAAGATGTTCGTTATTCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTGGTCAAGCCTCACGAGCAATTAGTACTGGTTAACTCAACGCCTCACAACGCTTACACACCCAGCCTATCAACGTCGTAGTCTCCGACGGCCCTTCAGGGGAATCAAGTTCCAGTGAGATCTCATCTTGAGGCAAGTTTCCGCTTAGATGCTTTCAGCGGTTATCTTTTCCGAACATGGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGTTCGTCCACCCGGTCCTTCCGTACTAGGAGCAGCCCCTCTCAAATTCAAACGTCCACGGCCAGATGGGGACCGAACTGTCTCACGACGTTCTAAGCCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATACCCTTAGACCGGCTTCAGCCCCAGGATGTGATGAGCCGACATCGAGGTGCCAAACACCGCCGTCGATAAACTCTTGGGCGGTATCAGCCTGTTATCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCTTCCATACAGAACCACCGGATCTTCAAGACCTACTTTCGTACCTGCTCGACGTGTCTGCTCTGATCAAGCGCTTTTGCCTTTATATTCTCTGCGACCGATTTCCGACCGGTCTGAGCGCACCTTCGTGGTACTCCTCCGTTACTCTTTTAGGAGGAGACCGCCCCAGTCAAACTGCCCACCATACACTGTCCTCGATCCGGATTACGGACCAGAGTTAGAACCTCAAGCATGCCAGGATGGTGATTTCAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCCACCTAATCCTACACAGCAGGCTCAGTCCAGTGCCGCTACAGTAAAGGTTCACGGGGTCTTTCCGTCGCCGCGGATACACTGCATCTTCACAGCGATTTCAATTTCACTGAGTCTCGGGTGGAGACAGCGCCGCCATCGTTACGCCACTCGTGCAGGTCGGAACTTACCCGACAAGGAATTTCGCTACCTTGGACCGTTATCGTTACGGCCGCCGTTTACCGGGGCTAGATCAGGCTTCGCGCCCCATCAATACTTCCGGCACCGGGAGGCGTCACACTTATACGCCGTCCACTTTCGTGTTTTGCAGAGTGCTGTGTTTTTAATAAACAGTCGCAGCGGCCTGGTATCTTCGACCAGCCAGAGCTTACGGAGTAAATCCTTCACCCTAGCCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTGCCTAGTTCCTTCACCCGAGTTCTCAAGCGCCTTGGTATTCTCTACCCGACCACCTGTGTCGGTTTGGGTGCAGTTCCTGGTGCCTGAAGCTTAGAAGCTTTTGGAAGCATGGCATCAACCACTTCGTCGTCTAAAAGACGACTCGTCATCAACTCTCGGCCTTGAAACCCCGGATTTACCTAAGATTTCAGCCTACCACCTTAAACTTGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGGTGGAACGTTCTGTTTATGTTTCTGAAA
>42262
AGCGTTCAGATTACGTATTGCTAGGGGGCAAAGATGAAGATGTTCGTTATTCTTTAGACTTGCCTGTCGCTCTATCTTCTCTTTTTGGTCAAGCCTCACGGGCAATTAGTACTGGTTAGCTCAACGCCTCACAACGCTTACAGCCTATCAACGTCATAATTCTTCTGACGGCCCTTCAGAATCAAGTTCCCAGTGAGATCTCATCTTGAGCAAGTTTCCCACCGTCTTTCAGCGGTTATCTTTTCGAACCTGCTTCCAGCAATACCACTGGCGTGACAACCGGAACACCAGAGGTTCGTCCACTCCGGTCCTCTCCGTACTAGGGCAGCCCTCTCAAATCTCAGAACGTCCACGGCAGATAGGACCGAACTGTCTCACGACGTTCTAAGCAGCTCGCGTACCACTTTAAATGGCGAACAGCCATGCAGGACCGGCTTCGGCCCCAGGATGTGATGAGCCGGCATCGGGTGCCAAACACCGCCGTCGATATAAACTCGGGCATTGACCTGTTATCCCCGGGTACCTTTTTATCGTTGAGCGATGGCCCTTCCATACCAGAACCACCGGATCACTACAGACCTACTTTCGTACCTGCTCGCTGTCTGTCGCGGCCAAGCGCTTTTGCTATGCTCTGCGACCGATTTCCGACCGGTCTGGGCGCACCTTCGTACTCCGTTGCCTCTTTTGGAGACCGCTGATCAAACTGCCCACCATACACTGTCCTCGATCCGGATTACCAGAGTTTAGAACTCAATGCCAGGGTGGTATTTCAAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCACCTATCCTACAAGCAGGCTCAAAGTCCAGTACAACTACAGTAGGTTCACGGGGTCTTTCCGTCTAGCCGCGGATACCTGCATCTTCAGCGTTTCAATTTCACTGAGTCTCAGGTGGAGACAGCGCCGCCATCGTTACGCCATTCGTGCAGGTCGGAACTTGCCGACAAGGAATTTTGCACCTTGGGACCATTCGTTACGCCGTTTACCGGGGCTGATCAAGAGCTTGCTTGCGCTAACCCCATCAATTAATTTTTCCGGCACCGGGGAGGCGTCACACCTACGTCCCACTGCGTGTTTGCAGAGTGCTGTGTTTAATAAGTCGCAGCAGCTCAGTATCTTCGACCAGCCAGAGCTTACGGAGTAAATCTTCACCTAGCCGGCGACCTTCTCCCGGAAGTTACGGTGCCATTTGCCTAGTTCCTCCGCACCCGAAAGCCCTTCGCGCCTTGGTATTCTCTACCCGACCTGTGTCGGTTTGGGGCACGGTTCCTGGCCTGAAGCAGAAGCTTTTCTTGGAAGCCTGGCATCAACCACTTCGTCATCTAAAAGACGACTCGTCATCAGCTCTCGGCCTTGAAACCGGATTTACCTAAGATTTCAGCCTACCACCTTAAACTTGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGTGGAGACGTTCTGTTTATGTTTCTATC
>50101
CCCGGTTACGTATTGCTAGGGGCAAAGATGAAGATGTTCGTTATTCGTACTAGACTTGCCTGTCGCTCTATCTTCTTTTTGGTCAAGCCTGCGGGCAATTATACTGGATAGCTCAACGCCTCACAACGCATACACCCAGCTTCTATCAACGTCGTAGTCTTCGACGGCCCTTCAGGAATCAAGTTCCCAGTGAGATCTCATCTTGAGGCAAGTTTCCCGCTTAGATGCTTTCAGCGGTTATCTTTTCCGAACATAGCTACCCGGCAATGCCACTGGCGTGACAACCGGAACACCAGAGGTTCGTCCACTCCGGTCCTCTCGTACTAGGAGCAGCCTCTCAAATCAAACGTCCACGGCAGATATAGGGACCGAACTGTCTCACGACGTTTCTAAACCCAGCTCGCGTACCACTTTAAATGGCGAACAGCCACCCTTGGGACCGGCTTCAGCCCCAGGATGTGATGAGCCGACATCGGGAACAAACACCGCCGTCGATATAAACTCTTGGGCGGTATCAGCCTGTTATCCCCGGAGTACCTTTTATCCGTTGAGCGATGGCCCTTCCATACAGAACCACCGGATCACTAAGACCTACTTTCGTACCTGCTCGACGTGTCTGTCTCGCAGTCAAGCGCGCTTTTGCTTTATACTCTGCGACCGATTTCCGACCGGTCTGAGCGCACCTTCGTACTCTCCGTTACTCTTTAGGAGACCGCCCCAGTCAAACTGCCCACCATACACTGTCCCTATCGATCCGGATTACGGACAGAGTTAGAACCTCAAGCATGCCAGGGTGGTATTTCAAGGATGGCTCCACGCGAACTGGCGTCCACGCTTCAAAGCCTCCACCTATCCTACACAAGCAGGCTCAAAGTCCAGTGCAAAGCTACAGTAAGGTTCACGGGTCTTTCCGTCTAGCCGCGGATACACTGCATCTCCACAGCGATTTCACCTCACTGAGTCTCTCGGGTGGAGACAGCGCCGCCATCGTTACGCCATTCGTGCAGGTCGGAACTTACCGACAAGGAATTTCGCTACCTTAGACCGTTATCGTTACGGCCGCCGTTTACCGGGGCTTCGATCAAGAGCTTCGCTTGCGCTAACCCCATCAATTAACCTTCGGCACCGGGGAGGCGTCACACCCTATACGTCCACTTTCGTGTTTGCAGAGTGCTGTGGCTTTTAATAAACAGTCGCAGCGGCCTGGTATCTTTTCGACCAGCCAGAGCTTACGGAGTAAATCCTTCACCTTAGCCGGCGCACCTTCTCCCGAAGTTACGGTGCCATTTGCTAGTTCCTTCACCCGAGTTCTCTCAAGCGCCTTGGTATTCTCTACCCGACCACCTGTGTCGGTTTGGGGTACGGTTCTGGTTACCTGAAGCTTAGAAGCTTTTCTTGGAAGCATGGCATCAACCACTTCGTCGTCTAAAGACGACTCGTCATCAGCTCTCGGCCTTGAAACCCCGGATTTACCTAAAGATTTCAGCCTACCACCTTAAACTTAGGGGGCAATATCAGCACCAACAGAAACTCTCTATACCATGGACAATGGATGAGTCTGGGTGGAAGTTCTGTTTATGTTTCTTGAGC

Continue reading

Fast, easy and robust DNA extraction for on-site bacterial identification using MinION

My name is Peter Rendbæk, and I’m currently a master student in the Albertsen lab. The overarching aim of my master project, is as a pre-test for several of the new big projects in the group, which focus on applying the on-line bacterial identification for process control at wastewater treatment plants. Hence, last couple of months I have been working on the project “Developing methods for on-site DNA sequencing using the Oxford Nanopore MinION platform”. The MinION has improved a lot since its release three years ago, and it can now be used to make rapid determination of bacterial compositions.

The potential for this fast and mobile DNA-sequencing is mind-blowing. However, given that the technology is here now (!), there has been relatively little focus on portable, fast, easy and robust DNA extraction. Hence, I’ve spent the last months on trying to develop a fast, cheap, mobile, robust and easy to use DNA extraction method.

There is a significant amount of bias connected with DNA extraction, but the bias associated with wastewater treatment samples has been investigated in depth. However, the “optimized method” is not suited for on-site DNA-extraction. There are 3 principle steps in DNA extraction, cell lysis, debris removal and DNA isolation, which I will cover below and discuss how I simplified each step.

In general, complex samples require bead beating for cell lysis and homogenization. The problem is that our in-house bead-beating is done by a big table top tool weighing 17 kg, which makes it hard to transport. However, I came across a blog post from loman labs about sample preparation and DNA extraction in the field for Nanopore sequencing. In the blog post, the possibilities of a portable bead beater outlined, by the use of a remodeled power-tool. I thought this was interesting, so I went out and bought an Oscillating Multi-Tool cutter and tried this with lots of duct tape…

The amazing part was that it worked! But the problem was that the samples would get “beaten” differently depend on how you taped the sample to the power-tool, which could give rise to variation large variations in the observed microbial community.

I solved this by 3D printing an adapter to the power-tool that fits the bead-beater tube (Finally, a good excuse to use a 3D printer!). I used Solidworks to design the adapter and collaborated with our local department of mechanical and manufacturing engineering (m-tech) in 3D printing it. You can make your own by simply downloading my design from Thingiverse (It did take a few iterations to make it durable enough, and I still use a little duct tape..).

 

After the bead beating, the cell debris removal is done by centrifugation. Our “standard” protocol recommends centrifugation at 14000 x G for 10 minutes at 4 C. However, in our minds that seemed a little extensive and requires a huge non-transportable centrifuge… Alternatively, there are a lot of possibilities to use small, easy to transport and easy to use centrifuges if we do not have to centrifuge at 14.000 xG at 4 C. There is even the possibility to 3D print a hand-powered centrifuge. However, I did not follow this path, as it seems a bit dangerous… After several tests, we discovered that a simple table top centrifuge could do the job perfectly well, using 2000 xG for 1 min at room temperature if we combined it with the DNA isolation described below.

The last step is DNA isolation, I tried several different methods, but we got the idea to simply use Agencourt AMPure XP that is routinely used in e.g. PCR purification (we 10 diluted the AMPure XP beads 1:10 to save some money and it seems to work just as good). And… It works..

So, now you have an overview of the method I developed. The most amazing part is that it works! It takes 10-15 minutes from the sample is taken until you’ve got ready DNA for use, compared to 60+ minutes for our “standard” protocol. Furthermore, it requires inexpensive equipment that can be carried in a small suitcase. So, just to prove that this approach is fast, I filmed myself doing the DNA extraction with a GO-PRO camera, as you can see below.

The next part is to test the MinION in the lab. How, fast can we identify bacteria and is the extracted DNA compatible with the downstream library preparation, which we hope to do on the our new and shiny Voltrax (which is now moving liquids!).